                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTCTGGTCGCACGATGTCTAGGTTGAGGCAGTCTTCGGAACCACGAATGCGATCAC
TTGGACCATAGGTTGGCTGCGCGGCTACAGACGCGTAGTGCGTGCAGTCTTTTATTTC
TTTCCACGGGTGCGGGGATGTTGGGGCGCGGAAGCGGTCGGCCCGCCCGTAGGGAACG
CCACGCCAAGTGCGCACCGCTGGGGTGGTGTCGGTGGCTGTGGTGCTTAACCCTCCTA
CTCGGCCAGACGTGGTACGTACTACGTCGTTGGGGGTCCAATCACTCATatgttttagagtagg
tgacATG

    DIP1006 Gene: DIP1006     GI: 38233601     BI number: DIP1006     GOG: COG0169     Description: shikimate 5-dehydrogenase family protei AC A  C G  A GC CG         C TA       A  C TA       G  A C  |       GT T  |       TA G  |       TG        AC AT        CG       G  G CG        AT       A  C GC       C  T       CG |  G      T  G       AT G  A      A  |       TA AT       G  |       CG GC        CG        GT T  |       GC       |  G TA       T  T       GC GC       A  G       CG GT       A  |       GT AT        GC        CG TG        CG        GC CG       A  C       TA TA        CG        CG GC        CG        GT                         CTTTTATTTCTTTCCACGGGTGCGGGGATGTTGGGGCGCGGAAGCGGTCGGCCCGCCCGTAGGGAACGCCACGCCAAGTGCGCACCGCTGGGGTGGTGTCGGTGGCTGTGGTGCTTAACCCTCCTACTCGGCCAGACGTGGTACGTACTACGTCGTTGGGGGTCCAATCACTCATatgttttagagtaggtgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0169 Shikimate 5-dehydrogenase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_diphtheriae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.80 kcal/mol Antiterminator: Size=40 nt.     Delta G= -6.50 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G=-13.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGTCTGGTCGCACGATGTCTAGGTTGAGGCAGTCTTCGGAACCACGAATGCGATCAC TTGGACCATAGGTTGGCTGCGCGGCTACAGACGCGTAGTGCGTGCAGTCTTTTATTTC TTTCCACGGGTGCGGGGATGTTGGGGCGCGGAAGCGGTCGGCCCGCCCGTAGGGAACG CCACGCCAAGTGCGCACCGCTGGGGTGGTGTCGGTGGCTGTGGTGCTTAACCCTCCTA CTCGGCCAGACGTGGTACGTACTACGTCGTTGGGGGTCCAATCACTCATatgttttagagtagg tgacATG     DIP1006 Gene: DIP1006     GI: 38233601     BI number: DIP1006     GOG: COG0169     Description: shikimate 5-dehydrogenase family protei AC A  C G  A GC         G CG       G  A TA       T  C TA        TC C  |       CA T  |       AT G  |       CA        AC AT        TG       G  G CG       A  G      A  C GC       G  T       CG |  G      C  |       AT G  A      G  |       TA AT        TT        CG GC        AG        GT T  |      A  G      |  G TA       G  C       GC GC       C  |       CG GT        AT        GT AT        CG        CG TG       C  C       GC CG        AG        TA TA        AC        CG                         TCTTTTATTTCTTTCCACGGGTGCGGGGATGTTGGGGCGCGGAAGCGGTCGGCCCGCCCGTAGGGAACGCCACGCCAAGTGCGCACCGCTGGGGTGGTGTCGGTGGCTGTGGTGCTTAACCCTCCTACTCGGCCAGACGTGGTACGTACTACGTCGTTGGGGGTCCAATCACTCATatgttttagagtaggtgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0169 Shikimate 5-dehydrogenase ... can be seen here     ..................................................................................................................