                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGAATTAGCACACCTGCGAGGCTCAGTGACGCACCGGCTGCAATGGCGATGAGCGT
GCGGGGGATTCGGCGTCCCCAGATGATGTGGCTGTTTGTTGGGTCGCCGTAGTGTCTA
AGAGCTGCAAGTATGTCAGGTGAGGTAATATTTCGAGCCCCGACTCCTAAACTCATAA
TGATCGTGCAGAGGAGGATGATTACAAGGAAAGTGATAACTAAAGGCAATGGTAGCCG
GACACGAGGTTGTCGAAGCATtagataattctaaccaattaatttgaaattagggtaacctgtccaacATG

    DIP1062 Gene: DIP1062     GI: 38233656     BI number: DIP1062     GOG: COG0614,COG4607,COG4592,COG4594     Description: Putative iron-siderophore uptake system exported solute-binding componen AT A  G CG GC         G |  G      C  G |  A      T  C |  T       TG |  G       AT TA        GC CG        GC GC        GC G  |       GC C  |      |  A CG       |  G AT       |  A CG       |  T GC       |  G CG       |  A A  G       GT G  |       CG T  |       GT G  |       TG A  |      G  | CG        CG TG        GC CG        AT             GTTTGTTGGGTCGCCGTAGTGTCTAAGAGCTGCAAGTATGTCAGGTGAGGTAATATTTCGAGCCCCGACTCCTAAACTCATAATGATCGTGCAGAGGAGGATGATTACAAGGAAAGTGATAACTAAAGGCAATGGTAGCCGGACACGAGGTTGTCGAAGCATtagataattctaaccaattaatttgaaattagggtaacctgtccaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG4607 ABC-type enterochelin transport system, periplasmic component ... can be seen here [P] COG4592 ABC-type Fe2+-enterobactin transport system, periplasmic component ... can be seen here [P] COG4594 ABC-type Fe3+-citrate transport system, periplasmic component ... can be seen here     ..................................................................................................................