                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-10.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGTGGTTCGTGATGATGGAGCTATTGAAAAGGCAGTGGATGAAGCCTTGGCCGCTA
ATCCCGATATTGTTGAGAAATACAAGGCTGGAAACACCAAGGTCACCGGCGCAATTGT
TGGTGCAGTGATGAAGGCTACGCGTGGCAAGGCTGACCCTGCTCAGGTAAATAAACTG
ATTGCAGAGAAACTCGCATAAcctcagcaattaggttgccccctttgatcgtgtgtattcgcgcgtttgaagggggatattttta
tctcttgccgcggtgagaagttgcgcgcacaataggggagtATG

    DIP1090 Gene: DIP1090     GI: 38233684     BI number: DIP1090     GOG: COG0667     Description: Putative aldo/keto-reductase family protei             a           t  g            tg            at            at   G        cg C  C       gc T  A      |  c       at C  T      |  c      t  t A  A      |  c       gc A  A      |  c       tg A  c      |  t       gc Gc       |  t       tg At        at        gc Gc        cg        cg A  a       ta       t  t Cg       c  t       at Gc       c  c       gt Ta       A  g       tg Ta        At        ta At        Tg        ta Gt        At        cg Ta        Cg        cg Cg        Gt        cg                         ggatatttttatctcttgccgcggtgagaagttgcgcgcacaataggggagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here     ..................................................................................................................