                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAGGAATCGTCGATAGTTAGAGCATTAAGCGCTATGACGTCCGCACGTGATGGGTC
CACTTCGGCAGTTGCCGCAGGACTCAAAACGTCGCGAATGCTGTCTTCCCATCGCTGC
GGTTCGAGCCCAGACCATGATCCTTGGATCACGACTGCTGAGGCCATGACCACTGCAA
ATCCTGCCAGCAGACGACTTATTTTCCTTATAAAAGATCGGCGACGCGCACGCACccgc
ctatttttccttgccatagtgattcatatgctagcaatcgcattcgttttcaacacactttacttacATG

    DIP1093 Gene: DIP1093     GI: 38233687     BI number: DIP1093     GOG: COG0435     Description: Conserved hypothetical protei            TA           T  T   A       C  A C  C      C  A C  T       TA A  G       TA GC        TG TA        TA A  A       AT C  A      T  C C  T       TG GC        CG GC       A  | AT        GC |  G       CG        CA |  C      A  A      G  C GC       G  C       CG TA       A  |       GC CG        CG       |  A GC        GC       C  C TA       A  |      A  c CG       C  |       Gc A  A       CG        Cg GC        GC        Gc CG        TA        Gc                         tatttttccttgccatagtgattcatatgctagcaatcgcattcgttttcaacacactttacttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0435 Predicted glutathione S-transferase ... can be seen here     ..................................................................................................................