                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-19.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGCTCTGCGTGTTGGTATCTCAGGCCAGGCTGTGTCGCCACCTCTGTTCGAGTCGA
TGGAGCTGTTGGGTAAGGAGTCAACGTTGACTCGTTTGCGTGCTACCCGTGAGGTCAC
CCCGTACCAGGTTGCTGCTGAATAAagctcatatcagacattcccctaggttaatcgcctaggggatttgttgttttaggga
ggaaaaattgttgcaactattgaatatgttgcttatgtgactaatgttaaacaagtgatatttgggtatgtgggccttggtggccgaagaaaaggtgcag
taGTG

    DIP1116 Gene: DIP1116     GI: 38233706     BI number: DIP1116     GOG: -------     Description: Putative exported esterase/hydrolas            gc           a  t           A  c   A       A  a C  C      T  t T  C      A  a GC        At         a GC        Gc       a  t A  G       Ta       t  c GT        Cg        tg TA       |  a       gc GC        Gc        gc |  C       Ta        at C  A      C  t       ta CG       G  t       cg CG       T  c       cg AT       T  c       cg T  T       Gc        cg CG        Gc        ta GC        At       |  t T  |      |  a      t  t GT        Cg        at CG        Cg        cg GC        At        at                         tgttttagggaggaaaaattgttgcaactattgaatatgttgcttatgtgactaatgttaaacaagtgatatttgggtatgtgggccttggtggccgaagaaaaggtgcagtaGTG     ..................................................................................................................