                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGATAACTCTGGATCTAGAGATGTGTTGGAGCGTTTGGCTCGTGAATTATGGCAAC
GCTTCGCCACTCAAGTGGAATGAgctggggttatatattttgaagttgggtcggtcgctgcggtgacgtggtcttaattactg
tcgcctaactggattttggtaggtaacccgttccaaaatggttgatacaaaagtcaatcgaaaggttgatttttgcggattactgctcagtggttatttt
tgccccaagccggaggtcaacgtcaggtgtcaacaactctcaacccagcttcgctccaaGTG

    DIP1153 Gene: DIP1153     GI: 38233743     BI number: DIP1153     GOG: COG0535     Description: Putative coenzyme PQQ synthesis related protei   g g  t a  a ta gc gc t  c t  g t  t t  | at gc gc ta c  a a  a       aa a  a      c  a t  t      a  a cg        tg        aa cg        at       g  a |  t       gc        cg gt        ta        tg cg        ta        at ta        gt        at gt        gc        cg ta        tg        ta                         tttttgcggattactgctcagtggttatttttgccccaagccggaggtcaacgtcaggtgtcaacaactctcaacccagcttcgctccaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0535 Predicted Fe-S oxidoreductases ... can be seen here     ..................................................................................................................