Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:54 nt.    Distance to gene:19 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-17.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAGAAT. It has a score value of 66.27 and is shown in blue

TTGAAGAACAACGTTCTCGAGTAGAATCCACCTCTCAATCTTTTAAAGAATGGGCGCT
AACTCCTGTTCGTAAATGAcattgaaaatgccagtgaatagatacactggcatttttcttatttggggtagcgatatcagtaTTG


    DIP1175 --- tyrS


Gene: DIP1175     GI: 38233765     BI number: DIP1175     GOG: COG2835     Description: Conserved hypothetical protein
Gene: tyrS     GI: 38233766     BI number: DIP1176     GOG: COG0162     Description: tyrosyl-tRNA synthetas


          ag
         t  a
         a  t
         a  a
          gc
          ta
          gc
          at
          cg
          cg
          gc
          ta
          at
          at
          at
          at
          gt
            cttatttggggtagcgatatcagtaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2835 Uncharacterized conserved protein ... can be seen here
[J] COG0162 Tyrosyl-tRNA synthetase ... can be seen here

    ..................................................................................................................