                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:117 nt.    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=37 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:55 nt.    Size=58 nt.     Delta G= -5.95 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-catggt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAGTGTTCTGTGActacatcatggttccgatctagcttaactgagtgcgaggatttccactgcatgtcgcactgagtttgtgca
ctcgggttcaattcgatcgggactaatcaaaaattatgatgacctaatgtgacaaaagccaacattgaacacctcacattagtgagttttgttggtttta
tGTG

    DIP1231 --- cobH --- cobIJ Gene: DIP1231     GI: 38233819     BI number: DIP1231     GOG: -------     Description: Conserved hypothetical protein Gene: cobH     GI: 38233820     BI number: DIP1232     GOG: COG2082     Description: precorrin-8X methylmutase Gene: cobIJ     GI: 38233821     BI number: DIP1233     GOG: COG1010     Description: Putative bifunctional cobalamin biosynthesis protei ta c  a at gc g  a g  a c  a t  a a  a g  t                 tt c  t                a  a t  a        c        cg t  t      a  a       at a  g      a  t       cg a  a      c  t       ta c  t      c  g       cg tg       g  a      c  t ta       a  a      a  t gc       a  c      c  t gc       a  a      a  | gt       a  c      a  | |  a      c  c      g  | c  a       at       t  | t  t       gc       t  | cg        ta        at at        gc        cg cg        ta        at |  a       at        at gc        at        cg ta        ta        cg                         ttttatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2082 Precorrin isomerase ... can be seen here [H] COG1010 Precorrin-3B methylase ... can be seen here     ..................................................................................................................