                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:213 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.72 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATAAATGGGATCGCCAGGACCCCCTAGAAGTAAACGAAACTGCGGTTCTTCGCTTAG
TGCTGATCTATGATGTAGATCAGTATTTTTCCTCAAGATTCGGAAAATTTCATGATTT
CCGTCGCCGATGCCAACAAGGTGGCCTTGACCAAAGAGCTCAGTAAGACTGTAGTCTG
CATCGTCAATACTGATATGACCGTATAGCCATGCGCCTATCCAAAGACTAGCGTTTTG
CAATGGACTGTAGAGATTGTCGCGGATATTCATagctttaaagaccttagcggataggctgtggtgttATG

    DIP1278 Gene: DIP1278     GI: 38233863     BI number: DIP1278     GOG: NOG05518     Description: Conserved hypothetical protei            TC           T  T            GT            GC AG        CG T  A       GC G  A      T  T TG       C  T AT       A  A tA       A  G tA       A  | |  A      G  | |  C      C  |        A |  G      A  |      G  T |  A      A  |       TG g  A       AT        AT tA        TG        TA gC        GC        CG g  T       AT        TA t  G      |  G       AT gC       |  A       GC tG        AT        TA cG        GC        CG gT        AT        GT gT        TA        TA                         TTTTTCCTCAAGATTCGGAAAATTTCATGATTTCCGTCGCCGATGCCAACAAGGTGGCCTTGACCAAAGAGCTCAGTAAGACTGTAGTCTGCATCGTCAATACTGATATGACCGTATAGCCATGCGCCTATCCAAAGACTAGCGTTTTGCAATGGACTGTAGAGATTGTCGCGGATATTCATagctttaaagaccttagcggataggctgtggtgttATG     ..................................................................................................................