Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGATG-TATGAT. It has a score value of 64.93 and is shown in blue

TGGATGCCGCCTTGGGGACCTCATATGATCACTGAAGACGGCCGTGAACAGTTGCGCG
CTTTAGGATTTTCCGTATAActatagccaagacgattttcccttcgcaggtgtccgtactttgacatggacacctgcttttcttt
tgtttacctagcgttgataggataacccgttGTG

    DIP1289 --- DIP1288


Gene: DIP1289     GI: 38233874     BI number: DIP1289     GOG: -------     Description: Putative ABC transport system ATP-binding protein
Gene: DIP1288     GI: 38233873     BI number: DIP1288     GOG: -------     Description: Conserved hypothetical protei


          tt
         t  g
         c  a
         a  c
          ta
          gt
          cg
          cg
          ta
          gc
          ta
          gc
          gc
          at
          cg
          gc
            ttttcttttgtttacctagcgttgataggataacccgttGTG
    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.60 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=72 nt.     Delta G=-10.51 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=47 nt.     Delta G= -6.22 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGATG-TATGAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATGCCGCCTTGGGGACCTCATATGATCACTGAAGACGGCCGTGAACAGTTGCGCG
CTTTAGGATTTTCCGTATAActatagccaagacgattttcccttcgcaggtgtccgtactttgacatggacacctgcttttcttt
tgtttacctagcgttgataggataacccgttGTG

    DIP1289 --- DIP1288


Gene: DIP1289     GI: 38233874     BI number: DIP1289     GOG: -------     Description: Putative ABC transport system ATP-binding protein
Gene: DIP1288     GI: 38233873     BI number: DIP1288     GOG: -------     Description: Conserved hypothetical protei


           cc
          t  c
          t  t
          t  t
          t  c
          a  g
          g  c
           ca
           ag
           gg
          a  t
           ag
           ct
           cc
          |  c
          |  g
          |  t
          |  a
          |  c
  G       |  t
G  A      |  t
A  T      |
T  T      |
T  T      |
T  T      |
C  C      |
 GC       |
 CG       |
G  T      |
C  A      |         tt
 GT       g        t  g
 TA        a       c  a
 TA        t       a  c
 Gc        a        ta
 At        t        gt
C  |       c        cg
A  |      A         cg
A  |       A        ta
G  |       T        gc
 Ta       A  |       ta
 Gt        T        gc
C  a       G        gc
 Cg       C  |       at
 Gc        C        cg
 Gc        T        gc
                        ttttcttttgtttacctagcgttgataggataacccgttGTG
    ..................................................................................................................