                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:59 nt.    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=29 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGAAA-AAAAAT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAAATACATGGGGCTCAGTTGAAAAATCAGTCACTTTTCAACGCTATTGAagaactgtg
tcaatagggttgaaaagtgtgagagacgtgctggttagggtgggctaacctgcacttttgtgggttatgactattggcggaatgaataacgtcatattag
tgttgctaaatggtatctaacgtttattggtcctcaagtcccgtactgatgggaccgtttggggattgattttcaatagaaactattcggaataggaggt
gaacgacTTG

    DIP1296 Gene: DIP1296     GI: 38233881     BI number: DIP1296     GOG: COG2345     Description: Putative DNA-binding protei   c a  t a  g g  t a  g At Gc Ta Ta At Ta Cg G  g Cg At         a At       g  g       tg Cg       a  a      g  g Ta        gc       g  g Ta        tg        gc Ta       g  t       at Ta       t  g       ta Cg        gc        ta At        at        gc Cg       a  g       gc T  |      a  g      t  t G  |       at        cg At        gt        gc Cg        ta        ta Ta        tg        gc                         ttttgtgggttatgactattggcggaatgaataacgtcatattagtgttgctaaatggtatctaacgtttattggtcctcaagtcccgtactgatgggaccgtttggggattgattttcaatagaaactattcggaataggaggtgaacgacTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2345 Predicted transcriptional regulator ... can be seen here     ..................................................................................................................