                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.42 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCAGAAATTTTGGGGCCGGTGAGCCTTCCTGCAGGAAACAAACTTCCGGGCGAATA
CGATGAAAATACCTATGGTCCGCCACAACGCGTGTTGATTCGTATTCCATTGAAAGAC
CGTAATGAACTAGGGGAAGTTTTACGATCTGGGATTGTGCAACGATCTGCTAAACGTA
AAGAATTACCTCTCCGCGTGAAAATCGATCCTATCCATGTAGGGTAGatgttttggcgtgagcct
atatatgtggactctatttgatttgtacttggcagaataagaagagactaaaggaaacaaaGTG

    DIP1323 --- fmt --- DIP1321 --- rpe Gene: DIP1323     GI: 38233909     BI number: DIP1323     GOG: COG0242     Description: Putative peptide deformylase Gene: fmt     GI: 38233908     BI number: DIP1322     GOG: COG0223     Description: methionyl-tRNA formyltransferase Gene: DIP1321     GI: 38233907     BI number: DIP1321     GOG: COG0144     Description: Conserved hypothetical protein Gene: rpe     GI: 38233906     BI number: DIP1320     GOG: COG0036     Description: ribulose-phosphate 3-epimeras            TA   G       T  C T  G      A  C CG        AT TA        GC AT        AT GT       A  C CG       A  C AT        TG TG        GC T  C       CG TA        AT        CA TA       |  G      C  T GC       A  A       TG |  G      A  A       AT A  A      T  A       TA AT       C  A       CG GC       G  T       CG GT       T  C       TG G  G       CG        AT GC        TA       G  A AT        AT        CG TA        GC        Ta                         tgttttggcgtgagcctatatatgtggactctatttgatttgtacttggcagaataagaagagactaaaggaaacaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0242 N-formylmethionyl-tRNA deformylase ... can be seen here [J] COG0223 Methionyl-tRNA formyltransferase ... can be seen here [J] COG0144 tRNA and rRNA cytosine-C5-methylases ... can be seen here [G] COG0036 Pentose-5-phosphate-3-epimerase ... can be seen here     ..................................................................................................................