                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCTAAAGATGGGTTGCCAGATACTCCGATTGCTAGTGCCTCCGTTCAAGCTATTGA
AGCACTTGAAAATCCTGCCGAGGGGGACTGGCTGTACTTCGTAACGATTGATAAAAAC
GGAACCACTGTGTTCACCAATAATTTTGAGGATCACCAAAATGCTACCCGCGATTCGA
TTGAAAATGGCGTGTTAGATAGCAATCGATAAgcgttaatgcgccttgtggccttatcctaaacaatcaggataag
gccattttatttttgttacgaacctaaaagcggcttggcgggggtatctaTTG

    DIP1347 --- DIP1346 Gene: DIP1347     GI: 38233933     BI number: DIP1347     GOG: COG0169     Description: Putative shikimate dehydrogenase Gene: DIP1346     GI: 38233932     BI number: DIP1346     GOG: -------     Description: Putative membrane protei GT        aa C  G      t  t GT        tg GT        gc TA        cg |  G       gc A  A      A  c       ca A  T      A  |      a  a A  A      T  |      a  t A  G       At       a  c GC        Gt        ta TA        Cg        cg TA       T  t       cg AT       A  g       ta GC       A  |       at CG        Cg        ta TA        Gc        ta T  T      |  c       cg A  A      |  t       cg G  A       At        gc Cg        Ta        gc Gc        At        ta Cg        Gc        gt                         tttatttttgttacgaacctaaaagcggcttggcgggggtatctaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0169 Shikimate 5-dehydrogenase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_diphtheriae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-19.50 kcal/mol Antiterminator: Size=41 nt.     Delta G= -7.20 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G=-12.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGCTAAAGATGGGTTGCCAGATACTCCGATTGCTAGTGCCTCCGTTCAAGCTATTGA AGCACTTGAAAATCCTGCCGAGGGGGACTGGCTGTACTTCGTAACGATTGATAAAAAC GGAACCACTGTGTTCACCAATAATTTTGAGGATCACCAAAATGCTACCCGCGATTCGA TTGAAAATGGCGTGTTAGATAGCAATCGATAAgcgttaatgcgccttgtggccttatcctaaacaatcaggataag gccattttatttttgttacgaacctaaaagcggcttggcgggggtatctaTTG     DIP1347 --- DIP1346 Gene: DIP1347     GI: 38233933     BI number: DIP1347     GOG: COG0169     Description: Putative shikimate dehydrogenase Gene: DIP1346     GI: 38233932     BI number: DIP1346     GOG: -------     Description: Putative membrane protei GT        gt C  G      c  t GT        ga GT        Aa TA        At |  G       Tg A  A      A  c A  T      G  |       ca A  A      C  |      a  a A  G       Tg       a  t GC        Ac       a  c TA        Ac        ta TA       C  t       cg AT       G  t       cg GC       A  |       ta CG        Tg        at TA        At        ta T  T      |  g       ta A  A      |  g       cg G  A       Gc        cg Cg        Ac        gc Gc        Tt        gc Cg        Tt        ta                         ttttatttttgttacgaacctaaaagcggcttggcgggggtatctaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0169 Shikimate 5-dehydrogenase ... can be seen here     ..................................................................................................................