                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:103 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCACTTTTTACGCAGTCCCCGATACACGCGTTCGCAATCAGGACACACAGGTGATCC
AGGTTTTGCTTGCTTAGTCACGGGGAATGCCTCTCCGCACAAAGCAACTACCATTCGA
CCGGACACCGCCGAATCCACGATCTGGTCTTTCTTCACATAATGGAAGAACTTTGGAG
TGTCATCTCCAGTGGTTGTTTCTTCCCTTATGTCAGGACGTTCGATAGTTTTCGTGCT
AGTACTCACgccccctatattgcaccattttgcgccaacttgcctacgcgggtctacccttgtgactcATG

    DIP1410 Gene: DIP1410     GI: 38233995     BI number: DIP1410     GOG: NOG08667     Description: Putative membrane protei            TA           A  A           C  T           A  G            CG   A        TA A  T       TA G  C       CG C  C       TA        TC C  A       TA       G  A GC       T  C      T  T CG       C  T       GC C  A      T  |       AT A  |       GT        GC C  |       GT        GC AT        TG        TA GC        CG        TG GT        TA       |  T CG       A  G       TG CG        GT        CG AT        CG        AT GC        AT        AT                         GTTTCTTCCCTTATGTCAGGACGTTCGATAGTTTTCGTGCTAGTACTCACgccccctatattgcaccattttgcgccaacttgcctacgcgggtctacccttgtgactcATG     ..................................................................................................................