                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-17.20 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCAAGTAATGCTTTTTAAgtcggatttttaactgtagtgctgcgatgacatgcactgatgattccctaggtgcggtgggatga
tgtgatcggctacactgtcggactgtagttggaggggagtaccccacccacggcattgatcgtcaacacggttaccatgcgagaattctcgtacgatccc
ggtcatgtcggtttactttgattttaggttatttgctcaagcaggccggatcagagtgagcgggggagacctccggttcatctgctcaacgattgagacc
ggaggtgtcttttatATG

    DIP1460 Gene: DIP1460     GI: 38234041     BI number: DIP1460     GOG: COG0861     Description: Putative membrane protei            ag           g  a ca        gc t  a       gc cg       |  t gc        gc ta        gc tg       |  g t  |       cg a  |       gt t  |       at tg        gc        tc gc        ta       c  a gc        gt       g  a a  g      a  |      t  c t  |      g  |       cg t  |      a  |       ta tg       c  |      |  t ta       t  |       at at       a  |       cg gc       g  |       ta ta       g  |      |  g tg       c  |       ta ta       c  |       gc cg       g  |       gc at        gc        cg tg        at        cg ta        cg        ta tg        gc        cg gc        at        cg                         tgtcttttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here     ..................................................................................................................