Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-20.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTGATTTGGGCGTTGCTTCCGGCAATGGCAAGGGACAAATCTTTGTCCGTGGTGAA
GTCATTAAGACAGTTCCAGAATCTCAAATTGTGGAGACTCTAATCGAAGAAGCCGTTC
GATTGGCGGAAGCAGAAGGCCTCGAAATTGAGGAGGGCGCTGGACCTCAGGTAAAAAT
TACTCGATAGtaattgacctctcggaggtttcaagggtgcatcggaatatttccgtgcaccctttcttatttgagctcgggcgttgcacaata
gagtgacgtcacgccagtgttagccttgtcgccATG

    DIP1497


Gene: DIP1497     GI: 38234076     BI number: DIP1497     GOG: -------     Description: Putative secreted penicillin-binding protei


            c
          t  g
           cg
           ta
           cg
           cg
          |  t
          |  t        a
 GA        at       t  t
C  T       gc        at
 TA        ta        at
 CG        ta        gc
 At       |  g       gc
 Ta       |  g       cg
 Ta       a  g      t  |
 At        at        at
 At        tg        cg
A  g       Gc        gc
A  |      A  |       ta
A  |       Ta        gc
 Ta        At        gc
 Gc        Gc        gc
 Gc        Cg        at
 At        Tg        at
                        tcttatttgagctcgggcgttgcacaatagagtgacgtcacgccagtgttagccttgtcgccATG
    ..................................................................................................................