Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTCGCAGATGCGATGCTTGCACAAGGTGTCATCTAAgttctgttaacgggtgcagtggccccctctagtaat
agtcgtgtgatgtctagtgacttcttggactcggagtccagttagttttttgacgcggagtccaggaagtttatggacatgacactctagtactagtcgg
tcgaaaaaattgactagtgtcagaggggtctttttgttgcacctaataagaggtagaactctataaaggggcaacacgcgccgatattaacaagcgacac
aacagttacttggttaccatgtttatcATG

    DIP1546


Gene: DIP1546     GI: 38234121     BI number: DIP1546     GOG: -------     Description: Conserved hypothetical protei


 gt
a  g
 cg
 gc
t  c
 gc
 gc
 gc
|  t
|  c
|  t
c  a
a  g       ag
 at       t  t
 ta        cg         g
 ta        ta       c  g
 gt        gc       t  a
 ta       t  t       cg
 cg        at        at
t  t       gc        gc
t  c      t  t       gc
g  g      g  t       ta
A  t      t  g       tg
A  g      g  |      c  t
T  t       cg       t  t
 Cg        ta        ta
 Ta        gc        cg
 At        at        at
                        tttttgacgcggagtccaggaagtttatggacatgacactctagtactagtcggtcgaaaaaattgactagtgtcagaggggtctttttgttgcacctaataagaggtagaactctataaaggggcaacacgcgccgatattaacaagcgacacaacagttacttggttaccatgtttatcATG


    ..................................................................................................................