Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:52 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTGGCTTATTAGTTGGTGGAGCTTGGGCCGCATATAAAGCCGATAACAAGTTCATGG
TGATTGTTCTCGGAGTTCTCGCTGCAATGGCTGCAGCAGGTGGCGTCGTGTGGGCGGT
AGGTATCTATCAGTAGccagtaggctgtagtagggggactcggttgacttttatatacctcgcgctaggctcgaagtagcgataaaaa
tttgttaaggctgggaagtaacttctcagcctttctattttgttcccccatactcaatagtcctttaatcctcgtcgacctctaaggaaggagcctGTG


    DIP1562


Gene: DIP1562     GI: 38234137     BI number: DIP1562     GOG: -------     Description: Putative transport membrane protei


            a
          a  a
          a  a
          t  t
           at
           gt
           cg
  a        gt
t  g       at
 cg        ta
 gc       g  |
c  t      a  |
 gc       a  |
 cg       g  |        a
 ta       c  |      t  a
c  a       ta        gc
 cg        cg        at
 at       g  g       at
 ta        gc        gc
|  g       at        gt
|  c       tg        gc
a  g       cg        ta
 ta       |  g       cg
 at       |  a       gc
 ta       g  a       gc
 ta        cg        at
 ta        gt        at
                        tctattttgttcccccatactcaatagtcctttaatcctcgtcgacctctaaggaaggagcctGTG


    ..................................................................................................................