                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-20.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTTGGATTCCTCGTCCGCACAAAGTAGTCATCAAGGTCGGTGAGGCTATTAGTCCGC
GCTCCTTTGTAAGCGATGCTGGTTATGATCCTGATTCCTATGAAGCTATGCGCTTTTT
TACGGATCATGTGATGAAGGTTCTCGCGGATCTGACAGGACAGCAGTACGTCGATTTG
TATGCGGCCGATGTTAAAAAGTCGCTTGCTGCGGGTAAGGGATACCCCGAAGGGGCTT
AGtgttgtgggtgttggatagtctagagtttgagagctatccaacaccttttgtgaatgtgagcatctGTG

    DIP1617 Gene: DIP1617     GI: 38234192     BI number: DIP1617     GOG: NOG05521     Description: Conserved hypothetical protei                      gt                     a  t                     g  t            CT       a  g           G  T       ta           G  A       cg           G  G       ta           G  t      |  g           A  g       gc            At        at            Gt        ta            Cg        at   G       |  t       gc G  G       Cg        gc A  A       Cg        ta AT        Cg        ta TA        At        gc GC        Tg        ta GC        At        gc GC        Gt        gc                         ttttgtgaatgtgagcatctGTG     ..................................................................................................................