                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-27.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -8.74 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTACTCTGGCGCATCCCATGTGGGAATCTACACCGGTAATGGAACTGTTATCCATGC
GTTAACGGAGGGTACTCCTTTGTCGGAAACCCCAATCGATTACATGCCTTTCTATAAC
GCAGTGCGTTACTAAaatacgaagagattagaggcctcagcacatgctgaggcctctatctttttatggagaactcttgggactagcca
catcgatgatggcatgtctatagtgggataatcgcttaagactgtgtagatatcggggaccgttcgtggctttttcaaaaatgacccatagggtcATG

    DIP1621 --- DIP1620 Gene: DIP1621     GI: 38234196     BI number: DIP1621     GOG: -------     Description: Putative secreted protein Gene: DIP1620     GI: 38234195     BI number: DIP1620     GOG: COG0438     Description: Conserved hypothetical protei             G           A  T            CG            GC            CG            AT            AT            TA   A       |  C A  C      |  T A  C      |  A GC       |  A GC       |  a |  A      |  a       ca C  A      |  t      a  t T  T      |  a       cg GC       |  c       gc TG       |  g       at TA       |  a       cg T  T      |  a       ta C  T      A  g       cg C  A       Ta        cg T  C       Cg        gc C  A       Ta        gc AT       |  t       at TG       |  t       gc GC       |  a       at GC        Tg       t  | GT        Ta        ta AT        Cg        at GT        Cg        gc GC        Gc        at                         ttttatggagaactcttgggactagccacatcgatgatggcatgtctatagtgggataatcgcttaagactgtgtagatatcggggaccgttcgtggctttttcaaaaatgacccatagggtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................