                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.36 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgacactccaaggtgatcaatgcgcccatatggtagtagctgaggtgtcctaagatctcttatctgctcagctggaacggaagtagagaccgctcaacta
cctgtagggcggatccgtctccgtgactgagaaactcacctacatttgcttccttctaaaaggccactgcttttcaacggccctagaaggcgtgggattc
tcattttaggatgatgcatatgcgatacccgcgctaggctgaaaccatgagaacaaccttgttgcgacaactgcgtggcgaaatcttttaggaggcacac
GTG

    DIP1656 Gene: DIP1656     GI: 38234229     BI number: DIP1656     GOG: COG4694     Description: Conserved hypothetical protei   t a  g g  a g  t a  g t  c       at t  a      c  g t  t      c  a ta       a  g at       a  a cg       a  a t  c       gc cg        ta         a ta       c  a      a  c t  t       gc       c  t a  a       gc       a  g gc        at        gc gc       t  t       cg gc        cg       g  t tg        gt       t  g gc       |  t       tg cg        cg        gc gc        gc        tg gt        cg        ta                         aatcttttaggaggcacacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4694 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................