                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATCATTGGTGCCGCCGGCGCTTTGGGTGACGCGGGCTCCCCAGCTTCGGATTCCAC
ACTTGGTCCTACAGCAGGTTTGAATGCGGATGGTCAGCATGACCACATTCGAGATTCA
GTTATTCCGACCTTCCTCCACTTCAACCTCCCGCTTATCGCAGCTGGTTGGGTGGCAG
CGATGGTTTTGTAAcaattaccttgcgggttgataacaatgtgtgtacatggtggcgggcatctttaaggcgacctacggtgggaattag
tattaatcccactacgccttaaggaggcacgtcaccATG

    DIP1660 Gene: DIP1660     GI: 38234233     BI number: DIP1660     GOG: -------     Description: Conserved hypothetical protei            TG TC       T  G A  G      G  G T  C      G  T TA        TG CG        CG GC        GC C  T      A  A C  |       CG C  |       GC T  |       CG CG        TA CG        AT AT        TG AT        TG             TTTTGTAAcaattaccttgcgggttgataacaatgtgtgtacatggtggcgggcatctttaaggcgacctacggtgggaattagtattaatcccactacgccttaaggaggcacgtcaccATG     ..................................................................................................................