                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=66 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGCCCGGGGCAACTACAAATCTCCAATTCGCCTTTGGTACTGGATACGGCAGTTT
GAGCGATGCCAAGTTAGTCTTGGGAAATTGCATTTTTGAAGGAAATCTAAGCAACATT
TAGagcagccccctaagtttctagagctctaattatcggagacccctagcgggtctctttttttgtgacactaacacagttcgaaaaaaattgcgaat
aatgcttgtaaggcttgcggtgagggggtaggatgaaagtgtccaaagggggaaaattaaggtaactaggccattgaggaggggaaATG

    DIP1733 Gene: DIP1733     GI: 38234304     BI number: DIP1733     GOG: -------     Description: Hypothetical protei             a           a  g           t  t           c  t           c  t           c  c           c  t           c  a           g  g           a  a            cg            gc            at            Gc            At            Ta            Ta           T  t           A  t           C  a   A       A  t A  C      A  c C  A      C  g GT       G  g AT       A  |        a AT       A  |      t  g TA        Ta       c  c CG        Cg        cg Ta        Ta        cg |  g      A  c       cg A  c      A  c       at A  a      A  |       gc A  g       Gc        at Gc        Gc        gc Gc        At        gt                         ttttttgtgacactaacacagttcgaaaaaaattgcgaataatgcttgtaaggcttgcggtgagggggtaggatgaaagtgtccaaagggggaaaattaaggtaactaggccattgaggaggggaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_diphtheriae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.20 kcal/mol Antiterminator: Size=34 nt.     Delta G= -6.20 kcal/mol Anti-antiterminator:   Size=18 nt.     Delta G= -5.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGGGCCCGGGGCAACTACAAATCTCCAATTCGCCTTTGGTACTGGATACGGCAGTTT GAGCGATGCCAAGTTAGTCTTGGGAAATTGCATTTTTGAAGGAAATCTAAGCAACATT TAGagcagccccctaagtttctagagctctaattatcggagacccctagcgggtctctttttttgtgacactaacacagttcgaaaaaaattgcgaat aatgcttgtaaggcttgcggtgagggggtaggatgaaagtgtccaaagggggaaaattaaggtaactaggccattgaggaggggaaATG     DIP1733 Gene: DIP1733     GI: 38234304     BI number: DIP1733     GOG: -------     Description: Hypothetical protei             A           T  C           A  G           G  G        A            GC       T  G            TA       T  T            CG        GC            AT        AT           T  T       AT           G  T       CG AT       G  |       CG a  G      T  |      |  G aT        TG       |  A gC        TA       G  A g  G      C  |       TA gC        CG        AT gC        GC        GT aT        CG        CG gT        TA        GC                         ATTTTTGAAGGAAATCTAAGCAACATTTAGagcagccccctaagtttctagagctctaattatcggagacccctagcgggtctctttttttgtgacactaacacagttcgaaaaaaattgcgaataatgcttgtaaggcttgcggtgagggggtaggatgaaagtgtccaaagggggaaaattaaggtaactaggccattgaggaggggaaATG     ..................................................................................................................