                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=77 nt.     Delta G=-25.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgctccttgggacgatgttgttgcgatccaattcgtttcggttccagagctgccactgtcgcctTTGGAAGCTATACATATCAA
GGCGTCAATAGCTGCCAGACTGCTTGTGAGTGATCCGAAGGAGGATTTATCAGTTCAC
AAGTTCAGTTCGTTGAGCCGTCGTTTACCCCCTGAAATAGGGGCGGTCTTTATTGAGA
TGACCAGCGATTTCTTCCGATTTTTTAAGAATCTCACTTATTCACTGTAAacttgcgcgtaca
cacaccacaccctctcgcaatgcaaattgtgatggtGTG

    DIP1759 Gene: DIP1759     GI: 38234330     BI number: DIP1759     GOG: COG4823     Description: Conserved hypothetical protei AG A  G G  A CG CG TA |  T |  T |  T |  A AT GC TA |  G GT AT GC TA GC TA TA CG GT T  T C  | A  |                  A G  |                A  A A  |                 GT C  |       GT        TA C  |      C  C       CG GC        CG        CG TA        GT        CG CG        AT        CG GT        GT       C  | AT       T  |      A  | |  C       TA       T  | TG        GC       T  | AT       C  C      T  | AT       T  C      G  | CG       T  C      C  | TA        GC       T  | G  |       AT        GC CG        CG        CG GC        TA        CG GC        TA        GT                         CTTTATTGAGATGACCAGCGATTTCTTCCGATTTTTTAAGAATCTCACTTATTCACTGTAAacttgcgcgtacacacaccacaccctctcgcaatgcaaattgtgatggtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG4823 Abortive infection bacteriophage resistance protein ... can be seen here     ..................................................................................................................