                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-28.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAAGTTCCACCCAGGTGAGAACGTCGGACGCGGTGGCGACGACACTCTGTTCGCACT
GAAGGCAGGCGCTGTTGAGTTCATCACCAAGCGCAACCGTCGTTTGGTCAACATTGTT
GAGAACGAGACTGTAGACGCCTAAgtcttacataattctctttgcagcacccgggcagcatttctgatttgtcagaagctgg
ctgggtgtttgtgtttttactcagcattttttactaagctatgactcacacatgggtgagtaatgctcctcggggagcaataaaggaaggcaacaaacac
taATG

    DIP1779 --- DIP1778 --- proB --- proA --- DIP1775 --- DIP1774 --- DIP1773 --- DIP1772 Gene: DIP1779     GI: 38234350     BI number: DIP1779     GOG: COG0536,COG1084     Description: GTP1/OBG-family GTP-binding protein Gene: DIP1778     GI: 38234349     BI number: DIP1778     GOG: -------     Description: Putative membrane protein Gene: proB     GI: 38234348     BI number: DIP1777     GOG: COG0263     Description: glutamate 5-kinase Gene: proA     GI: 38234347     BI number: DIP1776     GOG: COG0014     Description: gamma-glutamyl phosphate reductase Gene: DIP1775     GI: 38234346     BI number: DIP1775     GOG: COG1057     Description: Putative nicotinate-nucleotide adenylyltransferase Gene: DIP1774     GI: 38234345     BI number: DIP1774     GOG: COG0799     Description: Conserved hypothetical protein Gene: DIP1773     GI: 38234344     BI number: DIP1773     GOG: COG0406     Description: Phosphoglycerate mutase family protein Gene: DIP1772     GI: 38234343     BI number: DIP1772     GOG: COG1307     Description: Conserved hypothetical protei tt t  g at gc ta cg ta ta t  | a  | cg gc        tg at       g  t cg       t  t g  g      t  t gc       t  t gt        gt cg        ta cg        gc cg        gt at        gc cg        ta gt        cg at        gc             attttttactaagctatgactcacacatgggtgagtaatgctcctcggggagcaataaaggaaggcaacaaacactaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0536 Predicted GTPase ... can be seen here [R] COG1084 Predicted GTPase ... can be seen here [E] COG0263 Glutamate 5-kinase ... can be seen here [E] COG0014 Gamma-glutamyl phosphate reductase ... can be seen here [H] COG1057 Nicotinic acid mononucleotide adenylyltransferase ... can be seen here [S] COG0799 Uncharacterized homolog of plant Iojap protein ... can be seen here [G] COG0406 Fructose-2,6-bisphosphatase ... can be seen here [S] COG1307 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................