Gene putatively regulated by attenuation in C_diphtheriae
Characteristics of the secondary structures
Terminator: Distance to gene:82 nt. Distance to run of Ts=0 nt. Size=33 nt. Delta G=-10.60 kcal/mol
Antiterminator: Size=40 nt. Delta G= -5.50 kcal/mol
Anti-antiterminator: Size=39 nt. Delta G= -8.00 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
tgaagtagaactcacataaatcaacacaattgcctaccaccccgaacccacacgaaccaccccaacccgtacatccaccctaggaatcgactccttaata
cccccgaattatcctcagaatccacccctatggtcgcgtatctcctacaaggaaccactttcggctatcttaaccagtgaggttcgttgcttttcacaca
acaaaagcacggacttttgtagtgaagcagagaaaagaattttttaagagacagatcaacgttcatctgcctcatccccaggtcgcacaaggagcagaac
GTG
DIP1788
Gene: DIP1788 GI: 38234359 BI number: DIP1788 GOG: ------- Description: Putative TetR-family regulatory protei
c
t t
c a t
a a t a
t a c a
cg gc
cg gc ac
ta c | c a
c a t | a a
t c t | c c
a c ta ta
ta cg ta
gc at ta
| t | g ta
| t | a cg
c t cg gc
gc cg t |
cg at ta
tg at gc
gc gc cg
gt g g tg
ta at ta
at at gc
ttttgtagtgaagcagagaaaagaattttttaagagacagatcaacgttcatctgcctcatccccaggtcgcacaaggagcagaacGTG
..................................................................................................................