                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCATTTTGTCTTTGTAGTCTTGCGGGAGTTCGTCGCGGCCGTCGTTAAGCACGGATA
GGCTCATGGGCACCCAGGTGACGGATATGTCGCGGACTTTTTCTACTTCTTTGATCCA
TCGTGATGTGATCCAGCAAAATGGGCAGGATACATCGAACCAGAACGTCACGTTGTTA
GCCATgcgtatctccttcgtgctcgtgggtttcttttcttatcaacgctttggcccccaggggtttattccccgcggtatcgtggagagccgtaacc
tgcgaatatttttatttccaaggagttgtATG

    DIP1798 Gene: DIP1798     GI: 38234369     BI number: DIP1798     GOG: COG0308     Description: Putative aminopeptidas   A A  T A  G A  G       GA CG       A  A GC       C  C A  A       CG CG        AT CG       |  C TA       A  A A  |       GC GT        CG         c TA       T  T      c  t GC        AT       t  t TA        CG       c  c AT        AT        tg GC       |  T       at TG       T  A       tg G  A      A  G       gc C  A       GC       c  t T  C       GC        gc A  C      |  A       Tg C  A       AT        At CG        Cg        Cg TA        Gc        Cg                         gtttcttttcttatcaacgctttggcccccaggggtttattccccgcggtatcgtggagagccgtaacctgcgaatatttttatttccaaggagttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0308 Aminopeptidase N ... can be seen here     ..................................................................................................................