                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-21.60 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-23.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTTCTTGGACCGCACCTGTACCCACATCCTCGCGTGGGAAGGCAACGTTGCAGAAG
GCCAGTGGTTCTGGTTCGAGGGCAACTTCGAGGATTATGAAAGGAACAAGGTCGAGCG
CCTCGGTGCCGATGCTGCACGCCCATCGCGCGTGACACACCGCAAGCTCACCCGCTAG
cgtgacgcaccaagccacctcggcgtttttccgaggtggcttttgtgttttaggtaacacgctggtctagatactattgtggactaaacgacttttagga
ttgtagaaagtacacggcaaatttcaATG

    DIP1802 --- DIP1801 Gene: DIP1802     GI: 38234373     BI number: DIP1802     GOG: -------     Description: Conserved hypothetical protein Gene: DIP1801     GI: 38234372     BI number: DIP1801     GOG: NOG12977     Description: Conserved hypothetical protei CG C  C A  A C  A A  G C  C AT GC TA GC C  C GC CG GC C  T T  A A  | C  | C  | CG Gc Cg At Cg G  a T  c Cg Gc Ta |  c        t |  c      t  t |  a      g  t |  a      c  t |  g       gc |  c       gc |  c       cg |  a       ta |  c       cg |  c       cg At        at Gc        cg Cg        cg Cg        gc Gc        at Tg        at             ttgtgttttaggtaacacgctggtctagatactattgtggactaaacgacttttaggattgtagaaagtacacggcaaatttcaATG     ..................................................................................................................