                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caggattgccatagctcgtgatgttgcgggaatgaaacaggttgacttggcatctgctattggcgtatcgcgctcgaccgttgcgtcgatagagcagggg
gttagggaacctaggcgcggtgaggttatcgccatctcttttgccactggagtttctctacagtggcttgaaacaggaaaaacccccgcggggaatgatc
ctcgcgggggtgaagaagTGCGCCATCAGGGACTTGAACCCCGAACCCACTGATTAAGAGTCAGT
TGCTCTGCCAATTGAGCTAATGGCGCttctttgctTTG

    DIP1816 Gene: DIP1816     GI: 38234387     BI number: DIP1816     GOG: -------     Description: Putative membrane protei                      CA                     C  A                     G  T                     T  T                      CG                      TA   A                  CG A  G        G        GC T  A      A  T      T  T TG       C  T      T  A AT        TG       G  A GC        GC        AT TA        AT        CG CG        GC        TG AT        AT        GC                         GCttctttgctTTG     ..................................................................................................................