                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-17.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-21.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTGCTGTGGTCGCGGAATAGCTTGACCTCCCCTAGATCATCGGGGAGGGCGATAGC
GTCACGGGCGACGGCGAAACGTCCCGCGGAGGTATCGCCCATTTCATTGAACGGCACA
ACCAGGCCGGAAACTTCATTGTCTTTAGTGTCCGCCGCGCTTGCGGTCATAGGTGCCG
CGGTCAGCAAGGCGATTGTGGCGGCGGCGGTGAGTGTGGTGTCAGTCATtgttcttttccttgt
tgtcgggggatagccacggggcgaacctggctatccaggcttgcgcgggtgcgctggataaaATG

    DIP1827 Gene: DIP1827     GI: 38234398     BI number: DIP1827     GOG: -------     Description: Hypothetical protei GT G  C C  A GT TA TG CG GT CG GC         C C  C      G  G CG       G  A GC        AT CG        AT CG        CG        GT T  T      G  |      G  G GC        AT       T  T TA        CG        GC G  G       TG        TA A  C       GC       G  G T  |      G  G       AT TA        CG        GC TA        GC        TA CG        CG        GT TG        CG        Gt GC        GC        Cg TG        TG        Gt                         tcttttccttgttgtcgggggatagccacggggcgaacctggctatccaggcttgcgcgggtgcgctggataaaATG     ..................................................................................................................