                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACtaaccctaccgcgaaccgccggaaaagccacgagggggaggatttgcgctaagtattccagaacgtatattgtttgtcccagcaacGCGCCC
GTGGCGGAATTGGCAGACGCGCTGGATTTAGGTTCCAGTGTCTTAGGACGTGAGAGTT
CAAGTCTCTCCGGGCGCAcagtaacacagcaccgtctgaattgatcaggcggtgcttttgttttccctgttgctccaagacctcgaa
ctcatgaacgcgaaaaccgcaggacgcgaaaatcacccgaaattgtcgtcctgcggttttcGTG

    DIP1847 Gene: DIP1847     GI: 38234417     BI number: DIP1847     GOG: -------     Description: Hypothetical protei AG G  T A  T GC TA G  A       ca         t CG       a  c      t  g AT       a  a      a  a GC        tg        at |  T       gc        gc GC       a  a       ta AT       c  c       cg |  C      A  |       tg T  C      C  |       gc TG        Gc        cg CG        Cg        cg TG        Gt        at GC        Gc        cg TG        Gt        gc GC        Cg        at                         tttgttttccctgttgctccaagacctcgaactcatgaacgcgaaaaccgcaggacgcgaaaatcacccgaaattgtcgtcctgcggttttcGTG     ..................................................................................................................