                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=12 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agggaaggaagtgattctctcccaagtgcagcctttaaGGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGT
CACGGCGGAGGTCGCGGGTTCAAGTCCCGTCAGGGTCGcaagactgttcttgcagtctttGGCCAGA
TAGCTCAGTCGGTAGAGCACACGCCTGAAAAGTGTGGGGTCGCCAGTTCGATCCTGGC
TCTGGCCAcaaattaaggtcccagtcattttgactgggaccttgtttgttttcttctggtagaactggtgggaattgctactggaactagagga
ggcagatATG

    DIP1892 Gene: DIP1892     GI: 38234462     BI number: DIP1892     GOG: -------     Description: Conserved hypothetical protei             a         t           a  t      t  t           a  t      a  t           c  a       cg           A  a       ta            Cg        gc            Cg        at            Gt        cg            Gc        cg           T  c       cg CT       C  c       ta T  G       Ta        gc CG        Cg        gc GC        Gt        at GC        Gc        at TA        Ta        tg                         tttgttttcttctggtagaactggtgggaattgctactggaactagaggaggcagatATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_diphtheriae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-19.50 kcal/mol Antiterminator: Size=31 nt.     Delta G= -8.00 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G=-11.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case agggaaggaagtgattctctcccaagtgcagcctttaaGGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGT CACGGCGGAGGTCGCGGGTTCAAGTCCCGTCAGGGTCGcaagactgttcttgcagtctttGGCCAGA TAGCTCAGTCGGTAGAGCACACGCCTGAAAAGTGTGGGGTCGCCAGTTCGATCCTGGC TCTGGCCAcaaattaaggtcccagtcattttgactgggaccttgtttgttttcttctggtagaactggtgggaattgctactggaactagagga ggcagatATG     DIP1892 Gene: DIP1892     GI: 38234462     BI number: DIP1892     GOG: -------     Description: Conserved hypothetical protei AA G  A TA CG |  T CG GT CG |  G        C A  G      C  T CG       T  G AT       A  G        t |  C      G  C      t  t CG        CT       a  t GC        TC        cg A  C       TT        ta G  A       GG        gc A  G      A  G       at T  T      C  C       cg GT        CC        cg GC        GA        cg CG        Cc        ta TA        Ta        gc GT        Ga        gc                         ttgtttgttttcttctggtagaactggtgggaattgctactggaactagaggaggcagatATG     ..................................................................................................................