                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:181 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggtggccatccacagtgggcaaaatgaaaaaatttaatataaccccactttacagcagcttttttagaacaatccctttgttttgcacactttttgacgt
gtagcagaaatgttatttatccctctttttaggaactttctaagaaaacaaccgactatatatttacgcacctcacgttggtttgggtgtgggtccccat
gggcgtgcagtagatacgaatggtcgccaagccgtcatcccctcgtgtcgtgtgcatgccatcatggtgacctcgaatgatcgcagaaagttctcctctg
ATG

    DIP1898 --- DIP1899 --- DIP1900 --- DIP1901 Gene: DIP1898     GI: 38234468     BI number: DIP1898     GOG: COG1271     Description: Putative cytochrome ubiquinol oxidase subunit Gene: DIP1899     GI: 38234469     BI number: DIP1899     GOG: COG1294     Description: Putative cytochrome ubiquinol oxidase subunit Gene: DIP1900     GI: 38234470     BI number: DIP1900     GOG: COG4988     Description: Putative ABC transport system ATP-binding protein Gene: DIP1901     GI: 38234471     BI number: DIP1901     GOG: -------     Description: Putative ABC transport system ATP-binding protei            tt           t  g           t  a           t  c   c        cg c  c       at t  t       cg at        at at       |  a cg        cg at        gc at        ta gt        tg at        ta tg        ta             atgttatttatccctctttttaggaactttctaagaaaacaaccgactatatatttacgcacctcacgttggtttgggtgtgggtccccatgggcgtgcagtagatacgaatggtcgccaagccgtcatcccctcgtgtcgtgtgcatgccatcatggtgacctcgaatgatcgcagaaagttctcctctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1271 Cytochrome bd-type quinol oxidase, subunit 1 ... can be seen here [C] COG1294 Cytochrome bd-type quinol oxidase, subunit 2 ... can be seen here [CO] COG4988 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components ... can be seen here     ..................................................................................................................