Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggcataggggagtgctgtgctcgcagctcacgcagcaccagcctcatcgacgcattggaagagcccctaaacgggggtattccgaaggatttttctccg
aacttcacaccaaatcgcttccaaaccggccgtttgagcagatttggtgtgaagtgccgtctttttcgggggtgaacgggggtggcgcgctcaccaacgc
ccaccagccatcaacacatcggtgggagcagcaagaaaacgaagggtaacgtgaggggagcgtgtagttatgcaatcgaaaataccggaggtacaagcac
ATG

    DIP1921


Gene: DIP1921     GI: 38234488     BI number: DIP1921     GOG: NOG06582     Description: Conserved hypothetical protei


            t
          a  c
           cg
           ta
 ca       c  c
t  c       cg
 cg        gc
 gc       |  a
G  a      |  t       aa
T  |       at       a  c
A  |       cg        tg
c  |       cg        cg
a  |      a  a       cg
 cg       c  a       cg
 gc       g  |       cg
a  a      a  |       gt
a  c      c  |      a  a
c  c      g  |      g  |
a  a      c  |       at
 tg       a  |       at
 gc        cg        gc
 gc        ta        gc
 at        cg        tg
 gc        gc        ta
                        aggatttttctccgaacttcacaccaaatcgcttccaaaccggccgtttgagcagatttggtgtgaagtgccgtctttttcgggggtgaacgggggtggcgcgctcaccaacgcccaccagccatcaacacatcggtgggagcagcaagaaaacgaagggtaacgtgaggggagcgtgtagttatgcaatcgaaaataccggaggtacaagcacATG


    ..................................................................................................................