                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:208 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGTGGGGGTGATAAGTACATAGGGTGCTGTGGCGATGATCGGGTCGTCGCGGGTTCG
TAGTCCGATGCGTTGGTGGGTGAGCTTGGTCTTTTGGATGAAGCGGTGGGTGTTTTCC
GACACTGAGGAGAAGTAGATCACCTGCGGGCTTGTCGACGCTTCCACtgcggcctccttgcggtg
tagttgcggggcgagatgtggcggtagttcaccacatcaccaaaagttcaatgcattgaacttttggtgatgttcgcaatgtacgccacggcgactgtaa
aagaaaaccgcatacattaATG

    DIP1922 Gene: DIP1922     GI: 38234489     BI number: DIP1922     GOG: COG1272     Description: Putative membrane protei            TC           A  G           G  G       GC            TG       T  G            AT        AT   T        GC        GT A  G       CG        CG a  T       GT        CG t  A       GC       T  T t  G       TG       G  G a  G       GC       A  G cG        TG        TG aT        CG        GT tG       G  G       CG |  C      T  T       TA aT        GT        TG cG        GC        GC gT       G  G       GT cG        AT        GT cG        TA        CG                         GTCTTTTGGATGAAGCGGTGGGTGTTTTCCGACACTGAGGAGAAGTAGATCACCTGCGGGCTTGTCGACGCTTCCACtgcggcctccttgcggtgtagttgcggggcgagatgtggcggtagttcaccacatcaccaaaagttcaatgcattgaacttttggtgatgttcgcaatgtacgccacggcgactgtaaaagaaaaccgcatacattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1272 Predicted membrane protein, hemolysin III homolog ... can be seen here     ..................................................................................................................