                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-14.07 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCGACTGGCATTAGGTTGGGCCATTCCGACTTTTCGAGCACCGGCACCGAGGCTCC
CCTCTTCCACAATCGCCACAAAGAGTGCGAGAGTTTGCAGGTTCGGCCACCCATTATC
CATatcaacattatatgggtggatatgaaagtaccgtctaccgcgttcttttcaattagcgcaaccttgaagcatgtctacaaaccttctggaatcga
cgccgccctttacccaacttcgcaccggagtcctccagaagtacaccccgggcctgctcttatgctccattgcggtactcatcgctATG

    NCgl0014 Gene: NCgl0014     GI: 19551264     BI number: NCgl0014     GOG: COG2855     Description: uncharacterized membrane protei   A A  G A  A CG        tc AT       a  a C  |      T  a CG       A  c GC       C  a CG       C  t TA       T  t       aa A  G      A  a      g  a A  A      T  t       tg CG        Ta        at AT        At       |  a C  T       Cg       |  c C  T       Cg       |  c T  G       Cg        tg T  C       At        at C  |       Cg        gc TA        Cg        gt CG       |  a       ta CG       |  t       gc |  T      G  a       gc |  T       Gt       |  g |  C       Cg        gc CG        Ta        tg CG        Ta        at                         tcttttcaattagcgcaaccttgaagcatgtctacaaaccttctggaatcgacgccgccctttacccaacttcgcaccggagtcctccagaagtacaccccgggcctgctcttatgctccattgcggtactcatcgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2855 Predicted membrane protein ... can be seen here     ..................................................................................................................