                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:61 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-11.80 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=37 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGATG-tatctt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATGCTCATgcttcacttccttatcttttgaaaccatgtgcagctgtttttctcttcatttttctcttcatacactgacacagttcaact
caatcaaatagtcaactatgcaaggtagtcgactatgtggcatagtcgccatagttgagttttattcatggcttttagctaggcgactttagttgagggc
ttttagttgagggcttcccagcagggATG

    NCgl0018 --- NCgl0017 Gene: NCgl0018     GI: 19551268     BI number: NCgl0018     GOG: COG1651     Description: protein-disulfide isomerase Gene: NCgl0017     GI: 19551267     BI number: NCgl0017     GOG: COG0785     Description: cytochrome C biogenesis protei   a c  a g  g tg         t at       a  a ta        cg cg        gt at        gc a  c       tg cg       |  c ta        gc gc        ta at        at ta        ta at        cg a  g       at at        gt cg        cg tg        ta             gttttattcatggcttttagctaggcgactttagttgagggcttttagttgagggcttcccagcagggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1651 Protein-disulfide isomerase ... can be seen here [O] COG0785 Cytochrome c biogenesis protein ... can be seen here     ..................................................................................................................