                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATGCTGACTGTTTGTCTGATCGTGATGGGCAAATTATGGGAGACGTGGCTGCGTTG
GGGGACGAACGCGATTTCTGGCACAAGGTTGTTAATGCTTCCGCTGCGGGGTGCCAGC
ATGCCCGCCAAAGTTTCCAACAGTGTGGATTTTCCGGAGCCGTTGCTGCCGATGAGGG
CAGTTATTTTTCCGGTTGGGAAGCGTGCCGTGATGTTGTTGAGCGCGATGTGATTGCC
GTATGTGCATGTGAGATTCCGGACGCTGAGTTCTGCCATtccttaatgataacggttatcattttcaaAT
G

    NCgl0027 --- NCgl0026 Gene: NCgl0027     GI: 19551278     BI number: NCgl0027     GOG: COG1108     Description: ABC-type transporter, permease component Gene: NCgl0026     GI: 19551277     BI number: NCgl0026     GOG: COG0803     Description: ABC-type transporter, periplasmic componen   T T  T A  T GC GC TG        GT        TG |  G      C  T      A  A G  A       CG       G  G TG        GC        CG GC        AT        CG A  C      |  G       GC CG        GC        TA AT        GC        CG AT        CG        GT                         TATTTTTCCGGTTGGGAAGCGTGCCGTGATGTTGTTGAGCGCGATGTGATTGCCGTATGTGCATGTGAGATTCCGGACGCTGAGTTCTGCCATtccttaatgataacggttatcattttcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here [P] COG0803 ABC-type metal ion transport system, periplasmic component/surface adhesin ... can be seen here     ..................................................................................................................