                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.39 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTGCTGGCAATGGCAAATGCGGGCCCAGGCACCAACGGTTCCCAGTTCTTCATCAC
TGTGACCCCAACCCCTCACCTGAACAACGCTCACACCATCTTCGGTGAGGTCACTGAC
GCTGAGTCTCAGAAGGTTGTGGATGCAATTGCAACCACCGCAACCGATCGTTACGACC
GCCCAGCTGACGCAGTTGTCATCGAGTCTGTAGAGATCACCGCGTAAcagccacctctacgtaca
ctaatcttcaggttatgccgcaagccggtatgacctgatttttttatgccacaaaaacctgTTG

    NCgl0034 Gene: NCgl0034     GI: 19551285     BI number: NCgl0034     GOG: COG0705     Description: uncharacterized membrane protei   C T  T G  G A  T G  A       ta CG       g  c TA       c  a A  |      a  c CG       t  t TA       c  a        a GT       t  a      a  g T  C      c  t      c  c TA       c  c       gc GC       a  t       cg A  C      c  t       cg CG       c  c       gt GC       g  a       ta CG       a  g       at AT        cg        tg |  A       At        ta |  A       At        gc Gc        Ta        gc Ta        Gt        at Cg        Cg        cg Gc        Gc        ta                         tttttttatgccacaaaaacctgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0705 Uncharacterized membrane protein (homolog of Drosophila rhomboid) ... can be seen here     ..................................................................................................................