                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.70 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-12.27 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCACCTTTTGGTGGCGTAAAACAATCCGGAATGGGCCGCGAAGGTGGTCTCGAAGGAA
TCGAGGAGTACACCTCCGTGCAGTACATCGGTATCCGGGATCCTTACGCCGGCTAGca
tctgcccctttacaaatccaccgcaaacactgggatgtttgtggtggattttttgtgttttgggagctgcagttgtggagtaggtctgcgttaagttcga
cttcttaacaccgacttcagtgagaaaacctgacatcgccgtatttcccaaacgcaactgtgtgctgagataagatcagtaatcATG

    NCgl0048 Gene: NCgl0048     GI: 19551299     BI number: NCgl0048     GOG: -------     Description: hypothetical protei ca G  t A  c T  t Cg Gc Gc C  c C  c G  t C  t A  t T  a T  c C  a C  a Ta At Gc Gc G  | C  |       gg C  |      t  g T  |      c  a A  |       at Ta        cg Gc        at Gc        at Cg        at |  c       cg T  a       gt A  a       cg C  a       cg A  c       at Ta        cg Gc        cg At        ta Cg        at             tttttgtgttttgggagctgcagttgtggagtaggtctgcgttaagttcgacttcttaacaccgacttcagtgagaaaacctgacatcgccgtatttcccaaacgcaactgtgtgctgagataagatcagtaatcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-19.60 kcal/mol Antiterminator: Size=70 nt.     Delta G=-12.27 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G= -8.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCACCTTTTGGTGGCGTAAAACAATCCGGAATGGGCCGCGAAGGTGGTCTCGAAGGAA TCGAGGAGTACACCTCCGTGCAGTACATCGGTATCCGGGATCCTTACGCCGGCTAGca tctgcccctttacaaatccaccgcaaacactgggatgtttgtggtggattttttgtgttttgggagctgcagttgtggagtaggtctgcgttaagttcga cttcttaacaccgacttcagtgagaaaacctgacatcgccgtatttcccaaacgcaactgtgtgctgagataagatcagtaatcATG     NCgl0048 Gene: NCgl0048     GI: 19551299     BI number: NCgl0048     GOG: -------     Description: hypothetical protei            ac           c  c           c  g           t  c            aa            aa            aa           c  c           a  a           t  c           t  t           t  g           c  g           c AT       c G  C      c GC        g GT        t C  T       c C  A       t T  C      a  | A  |      c  | TG       G  |       gg GC       A  |      t  g GC       T  |      c  a CG        C        at TG        G        cg |  C       G        at |  T       C        at |  A      |         at A  G      C         cg C  c      G         gt A  a      C         cg T  t      A         cg Gc        T        at At        T        cg Cg        C        cg Gc        C        ta                         ttttttgtgttttgggagctgcagttgtggagtaggtctgcgttaagttcgacttcttaacaccgacttcagtgagaaaacctgacatcgccgtatttcccaaacgcaactgtgtgctgagataagatcagtaatcATG     ..................................................................................................................