                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -9.82 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAGTCCCGTGGCATCAGTCGCGATGGCGCAATTGTTGTCGTTCGCCCAGACCAGTAC
GTCGCAGCAGTCCTCCCACTCGAAGACACCGCAGCACTGGCTGAGTTCTTCAATGGCA
ATCTGCTTGAGCCATAAaccctaaattctaggaacgattccccggaaccttgagtggtttcggggttttgtgctttttcgacagaatg
agtgaacctgcgcttgaactataccccctggggtattactgtagattctcaataccccgaggggtatctagtttttacgttgagaaggagagctcaGTG

    NCgl0051 Gene: NCgl0051     GI: 19551302     BI number: NCgl0051     GOG: COG0491,COG0607     Description: Zn-dependent hydrolas             g           a  a           t  t           g  t           t  c       ga           c  t      c  g           a  c       cg            ta        cg ct        ta        cg c  g       at        at cg        ta        ta cg        gc        at cg        gc       a  c at        gc       c  t ta        gc        ta at        tg        cg                         tttttacgttgagaaggagagctcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:106 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-22.50 kcal/mol                                                                         Nomenclature/Definitions TGAGTCCCGTGGCATCAGTCGCGATGGCGCAATTGTTGTCGTTCGCCCAGACCAGTAC GTCGCAGCAGTCCTCCCACTCGAAGACACCGCAGCACTGGCTGAGTTCTTCAATGGCA ATCTGCTTGAGCCATAAaccctaaattctaggaacgattccccggaaccttgagtggtttcggggttttgtgctttttcgacagaatg agtgaacctgcgcttgaactataccccctggggtattactgtagattctcaataccccgaggggtatctagtttttacgttgagaaggagagctcaGTG     NCgl0051 Gene: NCgl0051     GI: 19551302     BI number: NCgl0051     GOG: COG0491,COG0607     Description: Zn-dependent hydrolas           ga          t  g          t  t           cg           cg           at           at           gt           gc           cg           cg           cg           cg          t  t          t  t           at           gt           cg           at             gctttttcgacagaatgagtgaacctgcgcttgaactataccccctggggtattactgtagattctcaataccccgaggggtatctagtttttacgttgagaaggagagctcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.10 kcal/mol                                                                         Nomenclature/Definitions TGAGTCCCGTGGCATCAGTCGCGATGGCGCAATTGTTGTCGTTCGCCCAGACCAGTAC GTCGCAGCAGTCCTCCCACTCGAAGACACCGCAGCACTGGCTGAGTTCTTCAATGGCA ATCTGCTTGAGCCATAAaccctaaattctaggaacgattccccggaaccttgagtggtttcggggttttgtgctttttcgacagaatg agtgaacctgcgcttgaactataccccctggggtattactgtagattctcaataccccgaggggtatctagtttttacgttgagaaggagagctcaGTG     NCgl0051 Gene: NCgl0051     GI: 19551302     BI number: NCgl0051     GOG: COG0491,COG0607     Description: Zn-dependent hydrolas           ga          t  g          t  t           cg           cg           at           at           gt           gc           cg           cg           cg           cg             ttttgtgctttttcgacagaatgagtgaacctgcgcttgaactataccccctggggtattactgtagattctcaataccccgaggggtatctagtttttacgttgagaaggagagctcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here     ..................................................................................................................