                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=3 nt.   Size=17 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -9.75 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATATTTGTTGCGTGATCGTAGAGTTCTTGGGTGAATTCCTCCGCAAAATCCTCGCG
CGGATTCCGGCGCACCTTAGCCACCCCACGTGTAATCGCGCGCTTGAACAAACCAGAA
TTTTCCTGGGACATgtgctcacactagcgccgtaggccggcttgcgctcggcaagtgttttgcttatcgacgtctccccacataacaatc
ccaactcgaagcaccaacgattcaagccttatcagttttgtacaggaaaatagtgcaaaaatggggtttaagcttcgtggagaggattgtcatcATG

    NCgl0081 Gene: NCgl0081     GI: 19551332     BI number: NCgl0081     GOG: -------     Description: hypothetical protei   T T  T A  T A  C GC AT CG CG A  G A  | A  | C  | A  | A  | G  | T  |       ca T  |      a  c C  |      c  t G  |       ta C  |       cg G  |       gc C  |       tg G  |       gc C  |      T  c T  |      A  | A  |       Cg        tg A  |       At       t  c TA       |  a       cg GC       |  g       gc TA       G  g      |  t GT        Gc        gc Cg        Gc        cg At        Tg        cg Cg        Cg        gc                         aagtgttttgcttatcgacgtctccccacataacaatcccaactcgaagcaccaacgattcaagccttatcagttttgtacaggaaaatagtgcaaaaatggggtttaagcttcgtggagaggattgtcatcATG     ..................................................................................................................