                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCGTGGTTTGGACAAGGTGGCGGAGTATCGCCCGGCTCGATCCACATAGCCGAAGG
GTTCGGTGCGGTCGATGGGTTTCCATTCCAGCACGTCAACGGTGAGTTTGGGGTAAAC
AACATCGGCGTATGCGGCGTAGTCCTCATTGTTGAGGGTTTCTTTGGCCAGTTTGGTC
GAGGTGTCGTAGATGTCAATGAGCTTCGCGATTGCGTCATCGATCGTTGTTGCTTCCA
TgcgcaccacactatctttctgcacgccctgatgccctgtggattcaaaactgtgcttttataggcgtATG

    NCgl0093 --- NCgl0092 Gene: NCgl0093     GI: 19551344     BI number: NCgl0093     GOG: COG0326     Description: molecular chaperone, HSP90 family Gene: NCgl0092     GI: 19551343     BI number: NCgl0092     GOG: NOG08629     Description: hypothetical protei CG A  G AT CG TA G  | CG AT        AT C  |      T  G GT        GC AT        CG CG       G  G CG        GC TG        CG TG       T  T AT       A  A C  |       CG C  |       AT TA       A  | TA       C  | TA       A  | GC       A  |       TG |  A      A  |      T  T G  A      T  |       AT GC        GC        CG TA        GC        TA AT        GT        CG GC        GC        CG CG        TA        TG                         TTTCTTTGGCCAGTTTGGTCGAGGTGTCGTAGATGTCAATGAGCTTCGCGATTGCGTCATCGATCGTTGTTGCTTCCATgcgcaccacactatctttctgcacgccctgatgccctgtggattcaaaactgtgcttttataggcgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0326 Molecular chaperone, HSP90 family ... can be seen here     ..................................................................................................................