                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:108 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggaaacctcggatctgtggtggattcgtgcaagattggcctctgaacttgcaaaaatccaccacgtttcgactgatcagagcaatttgtggtggatccta
accaatctggcagtggggtcggtgaattcattattggcgggcttttcaaaggtcatatgtcgattttggggcgaaaaatcgacacgttttctcgatgtgt
ttaagacatcaacatatggcttgtgctactgaaagatttttcttctgaaattctgtagaaacgctcctatgctcggggcagtaagttgtgagcataggaa
ATG

    NCgl0099 Gene: NCgl0099     GI: 19551350     BI number: NCgl0099     GOG: COG0667     Description: predicted oxidoreductas tg g  g a  g cg gt gc tg cg |  t |  g |  a |  a        c |  t      t  a |  t       ta |  c       ta |  a       tg |  t       cg |  t       gt ta        gc at       |  a at       |  t cg       |  a        g cg       g  t      g  c a  c       cg       g  g a  |       gt       g  a tg        gc        ta cg        tg        ta cg        ta        ta |  c       at        ta |  t      t  t       at t  t      t  t       gc at        at        cg gt        cg        ta gc        tg        gc ta        tg        ta                         cgttttctcgatgtgtttaagacatcaacatatggcttgtgctactgaaagatttttcttctgaaattctgtagaaacgctcctatgctcggggcagtaagttgtgagcataggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here     ..................................................................................................................