                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGGGAATCACTTGGGACATgtgaaaaagttaccacggaaatgttgttagatccagcactttctaacatttttatgttaggtct
tgcttttttataacatgatggcgttagattgttgttagtttcacgtgattcgcaccacgaactaatcggaattgtgagttcagcgctgaagctaagccag
attttgttgaatctaacacggatttaacgtgacggtttctcagtgtttttagcttctggcttttggcttctgatgctttagcgctggactcaacatttaa
aacaaaggtgaacacATG

    NCgl0109 Gene: NCgl0109     GI: 19551361     BI number: NCgl0109     GOG: COG0477     Description: hypothetical membrane permease protei   G         g T  a      a  a A  a      t  t c  a      t  c a  a       gc c  a       ta a  g       tg at        gc gt        ta ta       a  c gc        at gc        at        tt a  a       gt       t  t a  c       gc        ta a  g      c  |       at c  g      a  |       cg a  |      c  |       at a  |      c  |       at a  |       at        ta a  |       ta        cg ta        ta        tg ta        gc       t  t ta       |  a      t  c at        at       c  t cg        at        at at        at        cg at        at        gc cg        at        at                         tttttataacatgatggcgttagattgttgttagtttcacgtgattcgcaccacgaactaatcggaattgtgagttcagcgctgaagctaagccagattttgttgaatctaacacggatttaacgtgacggtttctcagtgtttttagcttctggcttttggcttctgatgctttagcgctggactcaacatttaaaacaaaggtgaacacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................