Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-19.50 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCGCAGATCTCTTCGTCCACTACTCTGAGATTCAGGGCTCCGGTTTCCGTAATCTTG
AGGAAAACCAGCCAGTTGAATTTGAGGTCGGCGAGGGCGCCAAGGGCCCACAGGCTCA
GCAGGTTCGTGCTCTCTAAgctctaactgctagctaaaaattccgcttcgtccttttcggacggggcggttttttaatgggtggat
tgtgcccctcgagatcgctcaatcgtctttattttcaattcattaagtcgttgacaattcgtaaaattgcgtctagaactaatgctataacggggagaAT
G

    NCgl0172 --- NCgl0173


Gene: NCgl0172     GI: 19551425     BI number: NCgl0172     GOG: -------     Description: hypothetical membrane protein
Gene: NCgl0173     GI: 19551426     BI number: NCgl0173     GOG: COG1846     Description: transcriptional regulato


            C
          T  T
          C  A
           TA
           Cg
           Gc
          T  t
          G  c
          C  t
          T  a
          T  a
  A       G  |
C  A       Gc
C  G       At
G  G       Cg
 CG        Gc
 GC        At
 GC       C  |
 GC        Ta
A  A       Cg
G  C       Gc
C  A       Gt
G  |      A  a
G  |      C  a
 CG       A  a
 TG       C  a        t
 GC       C  a      t  t
 GT       C  t      t  c
|  C       Gt        cg
|  A       Gc        cg
A  G       Gc        ta
 GC       A  g       gc
 TA       A  c       cg
 TG       C  t       tg
 TG       C  t       tg
 AT        Gc        cg
 AT        Cg        gc
 GC        Gt        cg
 TG        Gc        cg
                        ttttttaatgggtggattgtgcccctcgagatcgctcaatcgtctttattttcaattcattaagtcgttgacaattcgtaaaattgcgtctagaactaatgctataacggggagaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1846 Transcriptional regulators ... can be seen here

    ..................................................................................................................