Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:134 nt.    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttagt-tatgat. It has a score value of 66.93 and is shown in blue

tttagtatgttcgagactatcgggtatgatttcaacttgtcgcaaatatcaatttttgatgtttgagtcgctGGAGACGTGACAGAGC
GGCCGAATGTACTGGTCTTGAAAACCAGCGATGGGAAACCATCCGAGGGTTCAAATCC
CTCCGTCTCCGCAAatagcccccgtttacgcaggtaaacgggggttttctgattcttgggcggtcggggctttatccgaaagcactgttg
cctaaactagggcacATG

    NCgl0202


Gene: NCgl0202     GI: 19551456     BI number: NCgl0202     GOG: COG0633     Description: hypothetical protei


          ca
         g  g
          cg
          at
          ta
          ta
          ta
          gc
          cg
          cg
          cg
          cg
          cg
            ttttctgattcttgggcggtcggggctttatccgaaagcactgttgcctaaactagggcacATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG0633 Ferredoxin ... can be seen here

    ..................................................................................................................