Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttgttttgcacggagcggggacagcctgctcgaattcaggcgggttagcttcacagacggccggtttcgccgatgagtccgccccgttgtgcacacggc
gggtcaaacaaggcaggctttggcccgggacagcccctcctgctgaggaactcgccctgttttacacacgcggcgaacgaaacacggcgaactagcccgc
caaatggcacccccggctgggaaactcgccttgttttgcaccaacagggaacctggagcgcagtttcggggtctaagtaggtatgggagaaaaacggcgg
ATG

    NCgl0204


Gene: NCgl0204     GI: 19551458     BI number: NCgl0204     GOG: NOG25813     Description: hypothetical protei


           aa
          a  t
           cg
           cg
           gc
          |  a
          |  c
          |  c
          |  c
 ta       |  c       aa
c  g      c  c      g  a
a  c       cg        gc
a  c       cg        gt
 gc        gc       t  c
 cg        at        cg
 gc        tg        gc
 gc        cg        gc
                        ttgttttgcaccaacagggaacctggagcgcagtttcggggtctaagtaggtatgggagaaaaacggcggATG
    ..................................................................................................................