Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:50 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-14.00 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=42 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=36 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcta-tatttt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctaaggtaaaaatcacgggttattttaataggtggaagcggggcatgaaatagggtcctcagcaccaaccgctaaagcccgtgcattaagtacgggc
ttttgtcgttgtgagggggaattTTG

    NCgl0216


Gene: NCgl0216     GI: 19551470     BI number: NCgl0216     GOG: NOG26687     Description: hypothetical protei


            a
          c  a
          c  c
          a  c
           cg
           gc
 aa        at
a  t      c  a
g  a      t  a
t  g      c  a
a  g      c  |
 cg        tg
 gt        gc
 gc        gc
 gc        gc         t
 gt       a  |      t  a
c  c      t  |      a  a
g  a      a  |       cg
a  g      a  |       gt
a  |      a  |       ta
g  |      g  |       gc
 gc        tg        cg
 ta        at        cg
 gc        cg        cg
 gc        gc        gc
                        ttttgtcgttgtgagggggaattTTG
    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aggtaaacacgctgtttgcctggggttttgtcatgcttgtcaagtatttggtgtttgtaatttaggacagggacgcggcgtggaacttaaataagacgga
actgattgctgtttgtctgcttctcgaatgccgttgttttagagcaaaaacgatgggggtaaccgtgtcacccggtcttgctaaggtaaaaatcacgggt
tattttaataggtggaagcggggcatgaaatagggtcctcagcaccaaccgctaaagcccgtgcattaagtacgggcttttgtcgttgtgagggggaatt
TTG

    NCgl0216


Gene: NCgl0216     GI: 19551470     BI number: NCgl0216     GOG: NOG26687     Description: hypothetical protei


 ag
g  c
a  a
 ta
 ta        cg
 ta       c  t
 ta       a  g
 gc       a  t
 tg       t  c
 ta       g  a       aa
 gt        gc       t  g
 cg        gc        cg
 cg        gc        gt
g  |      g  g       ta
t  |       tg        ta
a  |       at       |  a
a  |       gc       |  a
g  |      c  |      |  a
c  |      a  |      c  t
t  |      a  |      t  c
c  |      a  |      g  a
 tg        at        gc
 tg        at        cg
 cg        cg        cg
 gt        gc        cg
 ta        at        at
                        tattttaataggtggaagcggggcatgaaatagggtcctcagcaccaaccgctaaagcccgtgcattaagtacgggcttttgtcgttgtgagggggaattTTG
    ..................................................................................................................