                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.32 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acggctgcaacgcatggctgctttgttctggggattagattacacaaaagtcgtttagaaactcaaatccgctcgcagttggcgttttctggggcggttc
agctagagttatgcgaaggatcccgtgcggcgtttatcttgtgaactcccccagggcaggaatgcagcaagggtcagcgagctctgacgggtgcgcggga
tcccctaaaacgtctagagtagtggcttgaggtcactgctctttttttgtgcccttttttggtccgtctattttgccaccacatgcggaggtacgcagtt
ATG

    NCgl0237 Gene: NCgl0237     GI: 19551491     BI number: NCgl0237     GOG: COG1167     Description: aspartate transaminas            at           g  c            gc            gc           c  c           g  t           c  a ga       g  a        g t  c      t  a      t  a cg       g  a      t  g tg       g  |       cg cg        gc        gt gt        cg        gc a  g       at        ta gc        gc        gc cg       |  t       at gc        ta        tg |  g       cg        gc a  g       ta        at cg        cg        gc ta        gt        at                         ttttttgtgcccttttttggtccgtctattttgccaccacatgcggaggtacgcagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KE] COG1167 Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.20 kcal/mol Antiterminator: Size=40 nt.     Delta G=-12.32 kcal/mol Anti-antiterminator:   Size=27 nt.     Delta G= -8.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case acggctgcaacgcatggctgctttgttctggggattagattacacaaaagtcgtttagaaactcaaatccgctcgcagttggcgttttctggggcggttc agctagagttatgcgaaggatcccgtgcggcgtttatcttgtgaactcccccagggcaggaatgcagcaagggtcagcgagctctgacgggtgcgcggga tcccctaaaacgtctagagtagtggcttgaggtcactgctctttttttgtgcccttttttggtccgtctattttgccaccacatgcggaggtacgcagtt ATG     NCgl0237 Gene: NCgl0237     GI: 19551491     BI number: NCgl0237     GOG: COG1167     Description: aspartate transaminas            at           g  c            gc            gc           c  c           g  t           c  a gg       g  a        g g  c      t  a      t  a aa       g  a      t  g cg       g  |       cg cg        gc        gt ca        cg        gc c  a       at        ta ct        gc        gc tg       |  t       at cc        ta        tg |  a       cg        gc a  g       ta        at ac        cg        gc ga        gt        at                         ttttttgtgcccttttttggtccgtctattttgccaccacatgcggaggtacgcagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KE] COG1167 Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs ... can be seen here     ..................................................................................................................